INTRODUCTION

Silkworm is an economically important insect produces the commercially important silk made of proteins. Being a delicate venture they are easily susceptible to a number of diseases, develops seasonally (Govindan and Devaiah, 1998 and Prasad, 1999). Controlling and checking of the incidence of seasonal disease is very important for desired output of silkworm rearing. And, presumably the most effective solution for the control of infectious dis- eases, is to detect infection as early as possible so as to stop spread of the disease in rearing house. Therefore

ARTICLE INFORMATION:

*Corresponding Author: medrraja@gmail.com Received 20th November, 2015

Accepted after revision 11th December, 2015 BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007 NAAS Journal Score : 3.48

©A Society of Science and Nature Publication, 2015. All rights reserved.

Online Contents Available at: http//www.bbrc.in/

technique that permits such detection of diseases at the earliest stage of infection is strongly needed. Therefore several advanced diagnostic methods are invented for detection of some microbial diseases, and their infection, VIZ : Agarose gel double diffusion, a dot-blot hybridi- zation assay, DNA hybridization, the enzyme-linked immunosorbent assay (ELISA) (Vanapruk et al., 1992), monoclonal antibody-based sandwich ELISA (Shamim et al., 1994), colloidal textile dye-based dipstick immu- noassay (Nataraju et al., 1995) and polymerase chain reaction (PCR)-based analysis (Burand et al., 1992; Woo et al., 2001 Awasthi et al., 2008 and Vootla et al., 2013).

189

Rashmi P. Joshi and I. A. Raja

Among these PCR-based technique offers an effec- tive, fast, reliable and practical method for the detection of microbial infection in all stages of silkworm ( Khum- noi, 2007). Polymerase chain reaction is a highly sen- sitive technique which ampli"es target DNA sequences of the causative agent of the disease. At the end of the reaction the resulting PCR (or ampli"cation) product to be electrophoreses and visualized on an Agarose gel. The winning ampli"cation of a DNA fragment will be indi- cated by a discrete band of the same size as the target length, i.e. the sequence !anked by the primers (Hunter- Fujita et al., 1998).

The viral Flacherie is an infectious disease caused by Bombyx mori densonucleosis virus (BmDNV). It is one of the pathogenic viruses of the lepidopteron insects, accounts for the signi"cant loss in commercial silk- worm rearing. Two isolates of BmDNV from B. mori, DNV1 and DNV2 have been previously reported in the

silkworms (Awasthi et al., 2008). This technology will hopefully provide a strategy for early detection of the diseases, which could help prevent crop loss and enable appropriate control measures to prevent spreading of pathogens, (Vootla et al., 2013).

MATERIAL AND METHODS

The experimental silkworms collected from the local farm- ers and were dissected for the midgut tissue. The genomic DNA was isolated from midgut tissue by the Kit method. We "nd the ampli"cation of DNV fragments by using spe- ci"c primers of DNV1 and DNV2. By using the primers of DNV1 (Densonucleosis virus 1) and DNV2 (Densonucle- osis virus 2). PCR was performed on the basis of previous studies and by the given protocol (Insect DNA extraction kit Nucleopore, Genetix ltd.) was followed. DNA extracted from the infected silkworms Bombyx mori from the midgut

tissue and ampli"ed with primers by speci"c DNV1 and DNV2 isolates. Molecular diagnosis of viral Flacherie was done PCR ampli"cation with Peltier PCR Processor Model NEO (BioEra) by speci"c primes. The primers used are DNV1 primer: 200 bp forward: 5’ AGAGGTGAACACGAAGAATA 3’, reverse: 5’ GGCGTGAAGTATGTGGAAAT3’. And DNV2 primer: 700bp, forward: 5’ GAAGATACTGTCCCAAATGA 3’ reverse: 5’ CCTTCAGGTTTAGCTTCTTG 3’.The robust DNA fragments of ~200bp size and 700bp size were ampli"ed. The ampli"ed bands obtained are then processed for Agar- ose Gel Electrophoresis at 65volts till the samples were run the 2/3rd gel length. The gels were visualized and con"rmed for the occurrence of DNV1 and DNV2 infection with GEL DOC. The visuals were photographed and saved in the PC.

RESULTS AND DISCUSSION

In the present work molecular con"rmation of infec- tion of viral Flacherie was reported using PCR with, spe- ci"c primers. PCR assays described by several authors

Rashmi P. Joshi and I. A. Raja

for detection and discrimination of viral pathogens in different insects, generally use degenerated primers and haemolymph or eggs as the DNA source (Burand et al., 1986; Moraes and Maruniak, 1997; Wang et al., 2000). In the experimental conditions determined by Wang et al., (2000), one-step PCR could detect about 0.57 ng of viral DNA.

PCR product of DNA extracted from the experimen- tal larvae of silkworm Bombyx mori for viral Flacherie were depicted in the Gel Plate I and Gel Plate II. Upon PCR ampli"cation, DNA extracted from Densonucleosis virus (DNV1 and DNV2) infected 5th instar silkworm larvae yielded the ampli"cation product of ~700 bps and ~200 bps and no PCR ampli"cation product were found when using DNA extracted from healthy non infected control larvae as well as infected with non viral Flacherie. The PCR products obtained was ~700bps and ~200bps for Viral Flacherie as expected and were in accordance to that obtained from the DNA extracted from DNV1 and DNV2 used as control the Marker in the lane M of both gel plates no. I and II.

Rashmi P. Joshi and I. A. Raja

The photo plate (Gelplate: I) Lane M loaded with DNA marker (1kb) and the healthy DNA sample from control with loading dye in 1st. in 2nd, 3rd, 4th, 5th, 6th and 7th Lanes the infected DNA samples along with loading dye were loaded In the results amplicons / bands generated at ~700bp, indicating and con"rming the sample to be of DNV2 virus, responsible for the reported viral Flach- erie (Lane 2, 4, 6, 7).

In gel plate II, Lane M loaded with DNA marker (1kb) and the healthy DNA sample from control with loading dye in 7th Lane, in1st, 2nd, 3rd, 4th, 5th, and 6th Lanes the infected DNA samples along with loading dye were loaded (Gel plate II). Electrophoresis was done of the loaded gel and current applied at 65 volts, till the samples run to 2/3rd length of gel. It was than visual- ized under UV illuminator (Gel Documentation machine) which shows clear single bands/amplicons at ~200bp in the loaded infected samples in 1st, 3rd, 4th, 6th, lane.

These amplication of DNA fragments by using speci"c primers of DNV1 and DNV2 con"rm the viral !acherie in the collected samples exhibiting mix infection of DNV isolates in Western Vidarbha region, Maharashtra, India.

Non-ampli"cation of any fragments from those infected with the bacterial !acherei may be due to absence of Viral !acherie infections (DNV1 and DNV2). Non-ampli"cation of any fragments from healthy and non-infected ones also did not amplify with either of the primers speci"c to DNV1 and DNV2.

As per the documentation of Awasthi et al., (2008), such study demonstrates the utility of PCR based identi- "cation of pathogenic infection of Indian B. mori using primers speci"c to disease isolates. Abe, (1993) had also applied PCR methods earlier for determination of Flach- erie virus from the fecal particles of B. mori. Sanburn and Cornetta (1987) and Scherr et al., (2001) used it for estima- tion of Lenti viral particle numbers and infection status of moloney murine leukemias virus. All these recommend this technology for its simplicity, reproducibility and short processing time. Such studied assist in better monitoring and effective health management of silkworms which is an economically important silk producing bio-machine.

ACKNOWLEDGEMENTS

We are thankful to Mr. Ahinsak Bagde, Scientist, grade-C, Department of Sericulture, Maharashtra State, Sholapur for technical information, guidance and critical reviews throughout the period of investigations.

REFERENCES

Abe H Shimada KK (1993). The nuclear syndrome virus con- centration detected by the chain reaction of Silkworm feces polymerase. J. Jpn. silkworm hybrid. 62(5): 376-381.

Awasthi AK., Pradeep AR., Srivastava P P, Vijayan K., Vineet Kumar& Raje S. Urs. (2008). PCR detection of densonucleosis virus isolates in silkworm (Bombyx mori) from India and their nucleotide variability. Indian Journal of Biotechnology, 7: 56-60.

Burand, JP., Orton HHM., Etnasami RS. & Elkinton JS. (1992). The use of polymerase chain reaction and shortwave UV irra- diation to detect baculovirus DNA on the surface of gypsy moth eggs. J. Virol. Methods, .36: 141-150.

Hunter-Fujita FR., Entwistle PE., Evans HF & and Crook NE. (1998). Insect Viruses and Pest Management in Bombyx mori. Willey and Sons, Chichester. L. J. Invertebr. Pathol. 63 : 151-156.

Govindan R., Narayanaswamy TK. and Devaiah MC. (1998). Principles of silkworm pathology. Seri. scienti"c publishers, Bangalore, p. 420.

Moraes RR. & Maruniak JE. (1997). Detection and identi"ca- tion Direct application of the new PCR protocol for evaluation and monitoring of Bombyx mori infection by nucleopolyhe- drovirus.of multiple baculoviruses using the polymerase chain reaction (PCR) and restriction endonuclease analysis. J. Virol. Methods, 63: 209-217.

Nataraju B. (1995). Studies on diagnosis and prevention of Nuclear polyhedrosis in silkworm, Bombyx mori L. Ph.D thesis, University of Mysore, Mysore, India.

Prasad NR. (1999). Silkworm disease management and its limi- tations. Indian Silk, 39(4): 7 – 9.

Sanburn N and Cornetta K, (1987). Rapid titer determination using quantitative real time PCR, Gene Ther, 6 (1999): 1340- 1345

Scherr M, Battmer K, Blomer U, Ganser A and Grez M, (2001). Quantitative determination of Lentiviral vector particle num- bers by real-time PCR. Biotechniques, 31 : 520-526.

Shamim MM, Baig, RK. Datta & SK. Gupta, (1996). Use of Monoclonal Antibodies to BmNPV for Early Detection of the Nuclear Polyhedrosis Disease in Bombyx mori L. Sericologia, 36(1): 75 - 85.

Sirinda Khumnoi. (2007). Vertical Transmission of Nucle- opolyhedrovirus in Thai Mulberry Silkworm, Bombyx mori L. (Lepidoptera: Bombycidae) Thesis. Graduate School, Kasetsart University.

Vanapruk P, Attathom T, Sanbatsiri K. & Attathom S. (1992). Comparison of methods for the detection of nuclear polyhe- drosis virus in silkworm, Bombyx mori Linn. pp 237-243.

Vootla Shyam Kumar, Xing Meng Lu, Neetha Kari, Mallikar- jun Gadwala, & Qineng . (2013) Rapid Detection of Infectious Flacherie Virus of the Silkworm, Bombyx mori, using RT-PCR and Nested PCR. J Insect Sci. 2013; 13: 120.

Wang CH, Yang HN., Liu HC, Kou GH, & Lo CF. (2000). Nested polymerase chain reaction and in situ hybridization for detec- tion of nucleopolyhedrosis. J. Virol. Methods, 84 : 65 - 75.

Woo PC, Chong KT, Leung, K, Que T. and Yuen K. (2001) Iden- ti"cation of Arcobacter cryaerophilus isolated from a traf"c accident victim with bacteremia by 16S ribosomal RNA gene sequencing. Diagn Microbiol Infect Dis 40, 125–127